View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10323_high_9 (Length: 228)
Name: NF10323_high_9
Description: NF10323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10323_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 68 - 217
Target Start/End: Original strand, 37331438 - 37331587
Alignment:
| Q |
68 |
gaagaggaacatgcgtagatgtgtttgtaattttgattgattcattcagatattatagtaacattgtcttacacatttaggaccaggacaggaccaattg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37331438 |
gaagaggaacatgcgtagatgtgtttgtaattttgattgattcattcagatattatagtaacattgtcttacacattttggaccaggacaggaccaattg |
37331537 |
T |
 |
| Q |
168 |
atgatgttttatccttctcgtttcttaagaaattgagatgatctctgctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37331538 |
atgatgttttatccttctcgtttcttaagaaattgagatgatctctgctt |
37331587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 148
Target Start/End: Complemental strand, 18199310 - 18199272
Alignment:
| Q |
110 |
cattcagatattatagtaacattgtcttacacatttagg |
148 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
18199310 |
cattaagatattatagtgacattgtcttacacatttagg |
18199272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University