View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10323_low_12 (Length: 228)

Name: NF10323_low_12
Description: NF10323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10323_low_12
NF10323_low_12
[»] chr5 (1 HSPs)
chr5 (68-217)||(37331438-37331587)
[»] chr2 (1 HSPs)
chr2 (110-148)||(18199272-18199310)


Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 68 - 217
Target Start/End: Original strand, 37331438 - 37331587
Alignment:
68 gaagaggaacatgcgtagatgtgtttgtaattttgattgattcattcagatattatagtaacattgtcttacacatttaggaccaggacaggaccaattg 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
37331438 gaagaggaacatgcgtagatgtgtttgtaattttgattgattcattcagatattatagtaacattgtcttacacattttggaccaggacaggaccaattg 37331537  T
168 atgatgttttatccttctcgtttcttaagaaattgagatgatctctgctt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
37331538 atgatgttttatccttctcgtttcttaagaaattgagatgatctctgctt 37331587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 148
Target Start/End: Complemental strand, 18199310 - 18199272
Alignment:
110 cattcagatattatagtaacattgtcttacacatttagg 148  Q
    |||| |||||||||||| |||||||||||||||||||||    
18199310 cattaagatattatagtgacattgtcttacacatttagg 18199272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University