View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10323_low_8 (Length: 268)
Name: NF10323_low_8
Description: NF10323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10323_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 7 - 72
Target Start/End: Complemental strand, 32955567 - 32955502
Alignment:
| Q |
7 |
cttgcttaagaatatggaaagagaattggataattctatttctatacatgttcttaacttcaatta |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32955567 |
cttgcttaagaatatggaaagagaattggataattctatttctatatatgttcttaacttcaatta |
32955502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 206 - 258
Target Start/End: Complemental strand, 32955364 - 32955312
Alignment:
| Q |
206 |
tattgatagtactattttagattggctatgaccatatatgaaatatccctttg |
258 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32955364 |
tattgatagtactcttttagattggctatgaccatatgtgaaatatccctttg |
32955312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University