View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10324_low_3 (Length: 406)
Name: NF10324_low_3
Description: NF10324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10324_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-125
Query Start/End: Original strand, 13 - 332
Target Start/End: Original strand, 9936423 - 9936739
Alignment:
| Q |
13 |
agcaaaggtagttaagtcttctttatctttgtgtttgttcctttcggttgttgtgcatattgtcggaagaaatagaaatattcactacagttgagtcact |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9936423 |
agcaaaggtagttaagccttctttatctttgtgtttgttcctttcggttgttgtgcatattgtcggaagaaatagaaatattcactacagttgagtcact |
9936522 |
T |
 |
| Q |
113 |
attaattaatctgcttcctaatcttttttgtgaaggaaattgttgcacggataagctggtgaatcatggtcatggcatagcagatgttgtttggtgggag |
212 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9936523 |
attatttaatctgctttctaatcttttttgtgaaggaaattgttgcacggataagctagtgaatcatggtcatggcatagcagatgttgtttggtgggag |
9936622 |
T |
 |
| Q |
213 |
gctatccctannnnnnnnagggaagacatttatagagacagatacaaacttttaaattaccgttttgcttaggtctcttacaaattgtatttttgttttt |
312 |
Q |
| |
|
|||||||| | |||||||||| |||||||||||||||| |||| |||||||||||||||||||||||| || | |||||||||| ||||| |
|
|
| T |
9936623 |
gctatcccca-tatttttagggaagacaattatagagacagatacggacttctaaattaccgttttgcttaggtcttttgc--tttgtatttttattttt |
9936719 |
T |
 |
| Q |
313 |
gtttctctttgagggttttg |
332 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9936720 |
gtttctctttgagggttttg |
9936739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University