View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10324_low_9 (Length: 242)
Name: NF10324_low_9
Description: NF10324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10324_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 50298276 - 50298500
Alignment:
| Q |
1 |
ccactcgtgggtttagtttatctaacatatatacactttgcagctcaaaaggaccctttaccagcaaaaccattgcttcaaggccaaccggattaaatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50298276 |
ccactcgtgggtttagtttatctaacatatatacactttgcagctcaaaaggaccctttaccagcaaaaccattgcttcaaggccaaccggattaaatca |
50298375 |
T |
|
| Q |
101 |
gttgccaaacatgtttggttgtggtgggtgctccacacgaactcaacaattaaccggacccatgatggttattttcatcatatgttgagctagattgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50298376 |
gttgccaaacatgtttggttgtggtgggtgctccacacgaactcaacaattaaccggacccatgatggttattttcatcatatgttgagctagattgaaa |
50298475 |
T |
|
| Q |
201 |
ttaaagaacataaaaataaaatagg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
50298476 |
ttaaagaacataaaaataaaatagg |
50298500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University