View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10325_high_11 (Length: 294)
Name: NF10325_high_11
Description: NF10325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10325_high_11 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 143 - 294
Target Start/End: Complemental strand, 34330426 - 34330275
Alignment:
| Q |
143 |
agcagagtttcaccagtagtgatcaatgttaacaatgaaacagaaagcattgttataccagatacaacaagatactcatctgcttcatcaatggatggtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330426 |
agcagagtttcaccagtagtgatcaatgttaacaatgaaacagaaagcattgttataccagatacaacaagatactcatctgcttcatcaatggatggtt |
34330327 |
T |
|
| Q |
243 |
atgcaaacatcagaaactatcgagctcgttctttccatgctgcaacaccaac |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330326 |
atgcaaacatcagaaactatcgagctcgttctttccatgctgcaacaccaac |
34330275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 11 - 75
Target Start/End: Complemental strand, 34330558 - 34330494
Alignment:
| Q |
11 |
cacagactcgacgatcccacctcagaactcagcatattcgacgcacacaaatacttcaacgaagg |
75 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34330558 |
cacaaactcgacgatcccacctcagaactcagcatattcgacgcacacaaatacttcaacgaagg |
34330494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University