View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10325_high_18 (Length: 262)
Name: NF10325_high_18
Description: NF10325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10325_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 108 - 244
Target Start/End: Original strand, 4015586 - 4015722
Alignment:
| Q |
108 |
gaaggaatggttttggaatacacgatgtatagggtgtctaacgatgctgaattcttccttatgttcaacgtgatatcccggaatacagattgtgttcttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015586 |
gaaggaatggttttggaatacacgatgtatagggtgtctaacgatgctgaattcttccttatgttcaacgtgatatcccggaatacagattgtgttcttc |
4015685 |
T |
|
| Q |
208 |
gtgattattgttaagagcgaagggtttcgtgtctgtg |
244 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
4015686 |
gtgattatttttaagagcgaagagtttcgtgtctgtg |
4015722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 102
Target Start/End: Original strand, 4015434 - 4015520
Alignment:
| Q |
16 |
ttccaaacacagagccagtactcaaaaccataaacagttttagaaacaacttccaaaagaagcaatccattacaggaatcaactatc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4015434 |
ttccaaacacagagccagtactcaaaaccataaacagtttcagaaacaacttccaaaagaagcaatccattacaggaatcaactatc |
4015520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University