View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10325_high_5 (Length: 343)
Name: NF10325_high_5
Description: NF10325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10325_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 47 - 249
Target Start/End: Complemental strand, 11313608 - 11313406
Alignment:
| Q |
47 |
gtattattattatgatgatgaaatagatccaagtgtacaatgtgagtatgtaatggagaagagatttataggtgaagaagttaataaggccagactggtt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313608 |
gtattattattatgatgatgaaatagatccaagtgtacaatgtgagtgtgtaatggagaagagatttataggtgaagaagttaataaggccagactggtt |
11313509 |
T |
 |
| Q |
147 |
ttcttcacattacaccgtctcttcttaatctcataagatgtgtcactataaatgctctgaaaggttgttgaaaaactttaaagttgaaatcaccccacct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11313508 |
ttcttcacattacaccgtctcttcttaatctcataagatgtgtcactataaatgctctgaaaggttgttgaaaaactttaaagttgaaatcaccccacct |
11313409 |
T |
 |
| Q |
247 |
gtc |
249 |
Q |
| |
|
||| |
|
|
| T |
11313408 |
gtc |
11313406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 297 - 328
Target Start/End: Complemental strand, 11313356 - 11313325
Alignment:
| Q |
297 |
agtagtacaatacaactagctagggcttcttc |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11313356 |
agtagtacaatacaactagctagggcttcttc |
11313325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University