View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10325_low_16 (Length: 275)
Name: NF10325_low_16
Description: NF10325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10325_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 40560580 - 40560464
Alignment:
| Q |
139 |
aaaatacattggtgacctttatcgacctttattgggtaatgacatctcatattggctattgatattgagatttcttttacttctgcatactctcatttcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40560580 |
aaaatacattggtgacctttatcgacctttattgggtaatgacatctcatgttggctattgggattgagatttcttttacttctgcatactctcatttcc |
40560481 |
T |
 |
| Q |
239 |
aactgacatctcttctt |
255 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40560480 |
aactgacatctcttctt |
40560464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 40560876 - 40560766
Alignment:
| Q |
4 |
caataaaacatgtttgcacccttgcttctatcacaataaccgcaaatggagtttggaatgtttgtatgcattaaaacattacaaattacagtaaaaagtt |
103 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
40560876 |
caataaaacatatttgcacccttgcttctatcacaataaccgcaaatggagtttggaatttttgtttgcattaaaacattacaaattacaataaaaagtt |
40560777 |
T |
 |
| Q |
104 |
tacaaccttac |
114 |
Q |
| |
|
||||||||||| |
|
|
| T |
40560776 |
tacaaccttac |
40560766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University