View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10325_low_31 (Length: 203)
Name: NF10325_low_31
Description: NF10325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10325_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 65 - 172
Target Start/End: Original strand, 36525272 - 36525379
Alignment:
| Q |
65 |
aaaagatgtgtttttaagcgtcaacttctggacttttttcaggtccatattagaagcacaattttcttctataacacttttttcttaaattgttttcttt |
164 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525272 |
aaaaaatgtgtttttaagcgtcaacttctggacttttttcaggtccatattagaagcgcaattttcttctataacacttttttcttaaattgttttcttt |
36525371 |
T |
 |
| Q |
165 |
atgctctt |
172 |
Q |
| |
|
|||||||| |
|
|
| T |
36525372 |
atgctctt |
36525379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 36525154 - 36525238
Alignment:
| Q |
1 |
catcaacaactgttttattctgtg--attctaattatgaattttacaaatgcaaacaaagttagagaaaagatgtgtttttaagc |
83 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
36525154 |
catcaacaactgttttattctgtgtgattctaattatgaattttacaaatgtaaacaaagttggagaaaatatgtgtttttaagc |
36525238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University