View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_high_9 (Length: 274)
Name: NF10326_high_9
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 116 - 208
Target Start/End: Original strand, 44872561 - 44872653
Alignment:
| Q |
116 |
actcaggttctatgttgaaatcaggaggtggtgaacgagaatccatatcaaaaactccaaatcttatatcaaactgcacaaaaacacaatttc |
208 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||| ||||| |
|
|
| T |
44872561 |
actcaggttctatgttgatatgaggaggtggtgaacgagaatccatatcaaaaactccaaactgtataccaatctgcacaaaaacactatttc |
44872653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 24 - 98
Target Start/End: Original strand, 44872313 - 44872387
Alignment:
| Q |
24 |
gtgtttgagggaacaccctccttcttcaatgcaactctcgcaggcttttctaagagaaatataattttttgcatt |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||||||||||||||||| | |||| ||||| ||||| |
|
|
| T |
44872313 |
gtgtttgagggaacaccctccttgttcaatgcaaacatggcaggcttttctaagagtagtatagtttttggcatt |
44872387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 5e-25; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 117 - 207
Target Start/End: Complemental strand, 47527101 - 47527011
Alignment:
| Q |
117 |
ctcaggttctatgttgaaatcaggaggtggtgaacgagaatccatatcaaaaactccaaatcttatatcaaactgcacaaaaacacaattt |
207 |
Q |
| |
|
||||||| ||||||||| |||||||||| |||||||||||||||||||||||||| ||| || |||| ||| ||||||||||||||||||| |
|
|
| T |
47527101 |
ctcaggtactatgttgatatcaggaggtagtgaacgagaatccatatcaaaaacttcaattcatataccaatctgcacaaaaacacaattt |
47527011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 24 - 104
Target Start/End: Complemental strand, 47527353 - 47527273
Alignment:
| Q |
24 |
gtgtttgagggaacaccctccttcttcaatgcaactctcgcaggcttttctaagagaaatataattttttgcattgttagg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||| ||||| |||||||||| |
|
|
| T |
47527353 |
gtgtttgagggaacaccctccttcttcaatgcaactcttgcaggcttttttaagagtaatatggtttttcccattgttagg |
47527273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 32 - 104
Target Start/End: Complemental strand, 47522096 - 47522024
Alignment:
| Q |
32 |
gggaacaccctccttcttcaatgcaactctcgcaggcttttctaagagaaatataattttttgcattgttagg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
47522096 |
gggaacaccctccttcttcaatgcaactctcacaggcttttctaagagtaatatggtttttcccattgttagg |
47522024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 117 - 183
Target Start/End: Complemental strand, 47521852 - 47521786
Alignment:
| Q |
117 |
ctcaggttctatgttgaaatcaggaggtggtgaacgagaatccatatcaaaaactccaaatcttata |
183 |
Q |
| |
|
|||||||| |||||||| |||||||||| |||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
47521852 |
ctcaggttttatgttgatatcaggaggtactgaacgagaagccatatcaaaaaatccaaatcatata |
47521786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University