View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_low_1 (Length: 575)
Name: NF10326_low_1
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 46; Significance: 6e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 29134552 - 29134630
Alignment:
| Q |
17 |
ctttggtgtatcccatgcaagcccaaataatctcccactcagcatgatttatgctgtttaccaaggc-atattaacgtgttac |
98 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||| |||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
29134552 |
ctttggtgtatcctatgcaagcccaaataatctcctactc----tgatttatgcggtttaccaaggcaatattaacgtgttac |
29134630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 9460730 - 9460808
Alignment:
| Q |
17 |
ctttggtgtatcccatgcaagcccaaataatctcccactcagcatgatttatgctgtttaccaagg-catattaacgtgttac |
98 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| |||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
9460730 |
ctttggtgtatcctatgcaatcccaaataatctcctactc----tgatttatgcggtttaccaaggccatattaacgtgttac |
9460808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 6e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 462 - 563
Target Start/End: Complemental strand, 51386288 - 51386187
Alignment:
| Q |
462 |
ttgcaaaagtaacgtttttcatggtcgtggttgtcgaattttgtttttctgggtatttaagtatggtggatttgaaatggctgtaaatactatgtgtctg |
561 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||| |||| | ||||| ||| ||||||||||||||||| ||| | |||||||||| || |
|
|
| T |
51386288 |
ttgctaaagtaacagttttcatggtcgtggttgtcgaattttgatttttttaatatttgagtttggtggatttgaaatggttgtgagtactatgtgtttg |
51386189 |
T |
 |
| Q |
562 |
tg |
563 |
Q |
| |
|
|| |
|
|
| T |
51386188 |
tg |
51386187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 18332461 - 18332409
Alignment:
| Q |
18 |
tttggtgtatcccatgcaagcccaaataatctcccactcagcatgatttatgc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18332461 |
tttggtgtatcccatgcaagcccaaataatcatccactcagcatgatttatgc |
18332409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University