View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_low_18 (Length: 252)
Name: NF10326_low_18
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 2517376 - 2517166
Alignment:
| Q |
18 |
agagaggagaatgggaggtgaaattttgggtggcgtagatatctctttgtgtgggaaacggagctagtgggtaacttggtggtattgttggaggggatag |
117 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2517376 |
agagaggagaatgggagttgaaatttcgggtggcgtagagatctctttgtgtgggaaacggagctagtgggtaacttggtggtaatgttggaggggatag |
2517277 |
T |
|
| Q |
118 |
tgataggtgaagggagagacgagtgggggtgggagccggagggtatgtttctcagtgaattctagttacaagaaacttgagaggttgtttttgttggatg |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
2517276 |
tgataggtgaagagagagacgagtgggggtggaggctggagggtatgtttctcagtgaattctagttacaagcaacctgagaggttgtatttgttggatg |
2517177 |
T |
|
| Q |
218 |
gtaatttatcc |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
2517176 |
gtaatttatcc |
2517166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 159
Target Start/End: Original strand, 21018491 - 21018619
Alignment:
| Q |
30 |
gggaggtgaaattttgggtggcgtagatatctctttgtgtgggaaacggagctagtgggtaacttggtggtattgttggaggggatagtgataggtgaag |
129 |
Q |
| |
|
|||||||| ||||| | |||||| ||| | || |||||||||||||||||||| |||| ||||||| || |||||||| ||| | || | || |||| |
|
|
| T |
21018491 |
gggaggtggaatttggtgtggcgaagagacctatttgtgtgggaaacggagcttgtggagaacttggggggtttgttggaaggggtgttggtgggggaag |
21018590 |
T |
|
| Q |
130 |
ggagagacgagtgggggtgggagccggagg |
159 |
Q |
| |
|
||||||| |||||||||||| |||||||| |
|
|
| T |
21018591 |
ggagaga-gagtgggggtggaggccggagg |
21018619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University