View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_low_19 (Length: 248)
Name: NF10326_low_19
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 30431199 - 30431332
Alignment:
| Q |
1 |
tggatcgcattggaatgttgatcactgaattaatcatgtggagagatgtaacaaaatcaaccctttggtttggttttggatctctttgtttcttatctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30431199 |
tggatcgcattggaatgttgatcactgaattaatcatgtggaaagatgtaacaaaatcaaccctttggtttggttttggatctctttgtttcttatctac |
30431298 |
T |
 |
| Q |
101 |
atgtttcaccaaaggaatcaattttaggtctgca |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30431299 |
atgtttcaccaaaggaatcaattttaggtctgca |
30431332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 174 - 234
Target Start/End: Original strand, 30431372 - 30431432
Alignment:
| Q |
174 |
gttatgtattctggaaattctgagatgttattgtgtttgttgtttcagcatattctctgct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30431372 |
gttatgtattctggaaattctgagatgttattgtgtttgttgtttcagcatattctctgct |
30431432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 103
Target Start/End: Original strand, 38774637 - 38774704
Alignment:
| Q |
36 |
atgtggagagatgtaacaaaatcaaccctttggtttggttttggatctctttgtttcttatctacatg |
103 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| |||||| | ||||| | |||||| |||| |
|
|
| T |
38774637 |
atgtggaaagatgtaacaaaatcaacgctttggtttggacttggatgtatttgtcttttatcttcatg |
38774704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University