View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_low_21 (Length: 248)
Name: NF10326_low_21
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 51729419 - 51729241
Alignment:
| Q |
1 |
tactcaaagctcttctctgcttcatattatctccaatggtataatgtaattaacatttgttactaaccgaatcatatcatatagtaaggaatacagcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51729419 |
tactcaaagctcttctctgcttcatattatctccaatggtataatgtaattaacatttgttactaaccgaatcatatcatatagtaaggaatacaacatt |
51729320 |
T |
|
| Q |
101 |
gaacnnnnnnntattctgttatggctgctaaatgtatagctaattgtttcttgatgtgcaatctaaaatagaggcttgg |
179 |
Q |
| |
|
|||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51729319 |
gaacaaataaatattctgttataggtgctaaatgtatagctaattgtttcttgatgtgcaatctaaaatagaggcttgg |
51729241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University