View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_low_24 (Length: 242)
Name: NF10326_low_24
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 19 - 139
Target Start/End: Original strand, 4575529 - 4575649
Alignment:
| Q |
19 |
atatacacggtcaatgcgtaagaaatcaattgtacgttacaaacctttgtagcaccgacattttaaattaaaggtgtgtttaatgtccaacacataagac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4575529 |
atatacacggtcaatgcgtaagaaatcaattgtacgttacaaacctttgtagcaccgacattttaaattaaaggtgtgtttaatgtccaacacataggac |
4575628 |
T |
|
| Q |
119 |
caacaattgtgatcatatttt |
139 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4575629 |
caacaattgtgatcatatttt |
4575649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 123 - 229
Target Start/End: Original strand, 4575664 - 4575770
Alignment:
| Q |
123 |
aattgtgatcatattttattgtnnnnnnntgtgattatactttatcaactcattttcttaaattattatcgatattgatggatgagtgttgtgtatctct |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4575664 |
aattgtgatcatattttattgtaaaaaaatgtgattatactttatcaactcattttcttaaattattatcgatattgatggatgagtgttgtgtatgtct |
4575763 |
T |
|
| Q |
223 |
ctgtgct |
229 |
Q |
| |
|
||||||| |
|
|
| T |
4575764 |
ctgtgct |
4575770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 114
Target Start/End: Original strand, 54083857 - 54083910
Alignment:
| Q |
61 |
acctttgtagcaccgacattttaaattaaaggtgtgtttaatgtccaacacata |
114 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||| ||||||| ||||||||| |
|
|
| T |
54083857 |
acctttgtagcaccgacacttttaattaaagacgtgattaatgttcaacacata |
54083910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 29711288 - 29711248
Alignment:
| Q |
172 |
tcattttcttaaattattatcgatattgatggatgagtgtt |
212 |
Q |
| |
|
||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
29711288 |
tcattttctcaaattattatcgatgttgatgcatgagtgtt |
29711248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University