View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_low_26 (Length: 240)
Name: NF10326_low_26
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 33 - 219
Target Start/End: Complemental strand, 38057406 - 38057220
Alignment:
| Q |
33 |
gacctaattttcaaagtgtgtaatatgattaatctattttgtgacctgtttacaagttacaacggtttcatagcactttatggctccctatcgccctcaa |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38057406 |
gacctaattttcaaagtgtgtaatatgattaatctattttgtgacctgtttacaagttacaacggtttcatagcactttatggcttcctatcgccctcaa |
38057307 |
T |
 |
| Q |
133 |
cctttagtgctccgaaagccctgccgccaaaatctcatcctttcaaaactgaaacacaaaaacaaagattaatcacattcacatcta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38057306 |
cctttagtgctccgaaagccctgccgccaaaatctcatcctttcaaaactgaaacacaaaaacaaagattaatcacattcacatcta |
38057220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University