View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10326_low_9 (Length: 302)
Name: NF10326_low_9
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10326_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 167 - 260
Target Start/End: Complemental strand, 1984073 - 1983980
Alignment:
| Q |
167 |
gttcaacatgatcacgaaaaagatcaacttatttcccatgtcttcctctactccttagtttggaaataaagtcttcaaatggtattgacacctt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||| ||| |||||||||||||||||||| ||||||| |
|
|
| T |
1984073 |
gttcaacatgatcacgaaaaagatcaacttatttcccatttcttcctctaatccctagttttgaattaaagtcttcaaatggtattcacacctt |
1983980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 44
Target Start/End: Complemental strand, 1991555 - 1991515
Alignment:
| Q |
4 |
atttggtgtgattaatgtgtgataagatttggtgaactcaa |
44 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
1991555 |
atttggtgtgattaatgtatgataagatttgttgagctcaa |
1991515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University