View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10326_low_9 (Length: 302)

Name: NF10326_low_9
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10326_low_9
NF10326_low_9
[»] chr8 (2 HSPs)
chr8 (167-260)||(1983980-1984073)
chr8 (4-44)||(1991515-1991555)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 167 - 260
Target Start/End: Complemental strand, 1984073 - 1983980
Alignment:
167 gttcaacatgatcacgaaaaagatcaacttatttcccatgtcttcctctactccttagtttggaaataaagtcttcaaatggtattgacacctt 260  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||||| ||| |||||||||||||||||||| |||||||    
1984073 gttcaacatgatcacgaaaaagatcaacttatttcccatttcttcctctaatccctagttttgaattaaagtcttcaaatggtattcacacctt 1983980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 44
Target Start/End: Complemental strand, 1991555 - 1991515
Alignment:
4 atttggtgtgattaatgtgtgataagatttggtgaactcaa 44  Q
    |||||||||||||||||| |||||||||||| ||| |||||    
1991555 atttggtgtgattaatgtatgataagatttgttgagctcaa 1991515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University