View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_high_13 (Length: 367)
Name: NF10327_high_13
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 1e-78; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 2907406 - 2907235
Alignment:
| Q |
1 |
cagagcccttggtgattgtctgtggcatactctttttccaaaaacatgtcaaaactt-atgttataagtgttaatagagtttgcaat--gcagtggcaca |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
2907406 |
cagagcccttggtgattgtctgtggcatactctttttccaaaaacatgtcaaaacttgatgttataagtgttaatagagtttgcaatatgcagtgacaca |
2907307 |
T |
|
| Q |
98 |
taaccttgcgtccttgctagtttgtctaaagttgttggaaattgttattgggtgggatgtatcccagaccaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2907306 |
taaccttgcgtccttgctagtttgtctaaagttgttggaaattgttattgggtgggatgtatcccagaccaa |
2907235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 253 - 350
Target Start/End: Complemental strand, 2906665 - 2906568
Alignment:
| Q |
253 |
ccatttgggagaattatagggctcataagtaacagtactagaaggagggaaacaatccatatttgtagcaaatatatgtagcaagcatatccatccac |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2906665 |
ccatttgggagaattatagggctcataagtaacagtactagaaggagggaaacaatccatatttgtagcaaatatttgtagcaagcatatccatccac |
2906568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 253 - 323
Target Start/End: Complemental strand, 2902550 - 2902480
Alignment:
| Q |
253 |
ccatttgggagaattatagggctcataagtaacagtactagaaggagggaaacaatccatatttgtagcaa |
323 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
2902550 |
ccatttgggagaattataggcctcgtaagtaacagtactggaagaagggaaacaatccatatttgttgcaa |
2902480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 220
Target Start/End: Original strand, 2907104 - 2907146
Alignment:
| Q |
178 |
ggattgattggggaagcaacaaaattttgcgtgactctagaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2907104 |
ggattgattggggaagcaacaaaattttgcttgactctagaaa |
2907146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 220 - 253
Target Start/End: Complemental strand, 2907236 - 2907203
Alignment:
| Q |
220 |
aatttttggaggtctattgtaatgatctttcttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2907236 |
aatttttggaggtctattgtaatgatctttcttc |
2907203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University