View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10327_high_21 (Length: 282)

Name: NF10327_high_21
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10327_high_21
NF10327_high_21
[»] chr4 (5 HSPs)
chr4 (16-272)||(42769382-42769638)
chr4 (18-261)||(42716901-42717147)
chr4 (140-261)||(42734738-42734862)
chr4 (199-264)||(42762694-42762759)
chr4 (16-87)||(42762505-42762576)


Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 16 - 272
Target Start/End: Original strand, 42769382 - 42769638
Alignment:
16 ataactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagttttgggtttaggtcctgtatttccagca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42769382 ataactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagttttgggtttaggtcctgtatttccagca 42769481  T
116 gaactaactacaacaatgccattagcaactgcatggaaagaccctatagcaatactgctttcataaaattctacgggatcaccacccacagacgccgaaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42769482 gaactaactacaacaatgccattagcaactgcatggaaagaccctatagcaatactgctttcataaaattctacgggatcaccacccacagacgccgaaa 42769581  T
216 tcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaatgtccgcttcat 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
42769582 tcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaatgtctgcttcat 42769638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 42716901 - 42717147
Alignment:
18 aactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagttttgggtttaggtcctgtatttccagcaga 117  Q
    |||||||||| ||||||||  ||||||||||||||||||| | |  ||| ||||||||||||||| ||||  | ||   |||||||| ||||||  |||     
42716901 aactagtgaactctctatcaattgtacttgcagcaactgtaaacacccatggttccaagttggatacagtactaggagcaggtcctgaatttcctccagc 42717000  T
118 actaactacaacaatgccattagcaactgcatggaaagaccctatagcaatactgctttcataaaattctacggg---atcaccacccacagacgccgaa 214  Q
    |   || ||||  |||  ||| ||||||||||||||||||||||| | ||||||||| || |||||||| || ||   ||||||||||| |||| | |||    
42717001 agccacaacaattatgttattggcaactgcatggaaagaccctatggaaatactgctatcgtaaaattcaacaggaaaatcaccacccaaagacactgaa 42717100  T
215 atcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaat 261  Q
    | ||| || ||||| |||  |||||||||||| ||||||||||||||    
42717101 agcacgtcgacaccatcacttatggcagcttcaaaaccagccaaaat 42717147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 140 - 261
Target Start/End: Complemental strand, 42734862 - 42734738
Alignment:
140 gcaactgcatggaaagaccctatagcaatactgctttcataaaattctacggga---tcaccacccacagacgccgaaatcacatcaacaccgtcaagta 236  Q
    ||||||||||||||||||||||| | ||||||||| || | |||||| || |||   ||||||| || |||| | |||| |||||||||||| |||  ||    
42734862 gcaactgcatggaaagaccctatggaaatactgctatcgtgaaattcaacaggaaaatcaccactcaaagacactgaaagcacatcaacaccatcactta 42734763  T
237 tggcagcttcgaaaccagccaaaat 261  Q
    |||||||||| ||||||||||||||    
42734762 tggcagcttcaaaaccagccaaaat 42734738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 42762694 - 42762759
Alignment:
199 acccacagacgccgaaatcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaatgtc 264  Q
    ||||| |||| |||||| |||||||||||| |||  |||||||||||| |||||||||||||||||    
42762694 acccaaagacaccgaaagcacatcaacaccatcacttatggcagcttcaaaaccagccaaaatgtc 42762759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 16 - 87
Target Start/End: Original strand, 42762505 - 42762576
Alignment:
16 ataactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagt 87  Q
    |||||| ||||| ||||||||  |||| |||||||||||||||| || ||| ||||||||||||||| ||||    
42762505 ataacttgtgaaatctctatcaattgtgcttgcagcaactgtgagcgtccaaggttccaagttggatacagt 42762576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University