View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_high_30 (Length: 236)
Name: NF10327_high_30
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_high_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 58 - 96
Target Start/End: Original strand, 9533746 - 9533784
Alignment:
| Q |
58 |
gatgggttgttcctaaaccaaccctaaattggtgtaagg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9533746 |
gatgggttgttcctaaaccaaccctaaattggtgtaagg |
9533784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 9533871 - 9533910
Alignment:
| Q |
183 |
ttcaatctttttccagtataggatcaaatggggcaaaagg |
222 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9533871 |
ttcaatctttttccagtatagaatcaaatggggcaaaagg |
9533910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University