View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10327_high_30 (Length: 236)

Name: NF10327_high_30
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10327_high_30
NF10327_high_30
[»] chr2 (2 HSPs)
chr2 (58-96)||(9533746-9533784)
chr2 (183-222)||(9533871-9533910)


Alignment Details
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 58 - 96
Target Start/End: Original strand, 9533746 - 9533784
Alignment:
58 gatgggttgttcctaaaccaaccctaaattggtgtaagg 96  Q
    |||||||||||||||||||||||||||||||||||||||    
9533746 gatgggttgttcctaaaccaaccctaaattggtgtaagg 9533784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 222
Target Start/End: Original strand, 9533871 - 9533910
Alignment:
183 ttcaatctttttccagtataggatcaaatggggcaaaagg 222  Q
    ||||||||||||||||||||| ||||||||||||||||||    
9533871 ttcaatctttttccagtatagaatcaaatggggcaaaagg 9533910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University