View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_high_38 (Length: 219)
Name: NF10327_high_38
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_high_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 20 - 102
Target Start/End: Original strand, 43183001 - 43183083
Alignment:
| Q |
20 |
ctaagcatggtacaagccaaaaaattcggattatatcaattataataccatttatgatgataatgtaaattccactgctctta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43183001 |
ctaagcatggtacaagccaaaaaattcggattatatcaattataatactatttatgatgataatgtaaattccactgctctta |
43183083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University