View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_high_39 (Length: 217)
Name: NF10327_high_39
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 9939951 - 9939841
Alignment:
| Q |
1 |
atgttaaaattaattttgttgttgaagtatagaggtattatactcgtctattatgttgggtatggtatcgacatt-ttttggtagcaatcaccaacacca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
9939951 |
atgttaaaattaattttgttgttgaagtatagaggtattatactcgtctattatgttgggtatggtatcgacatttttttcgtagcaatcaccaacacca |
9939852 |
T |
 |
| Q |
100 |
tcgattatacc |
110 |
Q |
| |
|
||||||||||| |
|
|
| T |
9939851 |
tcgattatacc |
9939841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University