View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_high_40 (Length: 217)
Name: NF10327_high_40
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_high_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 1633469 - 1633574
Alignment:
| Q |
18 |
aagggcccttcccttctctgttggtttcaatgcttttattatttttatgacctatgaattttctaaacatgtgagcctatttgactttgggctgcttgtt |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1633469 |
aagggcccttcccttctctgctggtttcaatgcttttattatttttatgacctatgaattttctaaacatgtgagcctatttgactttgggctgcttgtt |
1633568 |
T |
|
| Q |
118 |
gtcaac |
123 |
Q |
| |
|
|||||| |
|
|
| T |
1633569 |
gtcaac |
1633574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 205
Target Start/End: Complemental strand, 10866087 - 10866036
Alignment:
| Q |
156 |
ccaaaattaggatctacaaaatcacat--tggaggtacaacaaaaccctatg |
205 |
Q |
| |
|
||||||||||||| |||||||| | || ||||||||||||||||||||||| |
|
|
| T |
10866087 |
ccaaaattaggatatacaaaataatatattggaggtacaacaaaaccctatg |
10866036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University