View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_high_9 (Length: 396)
Name: NF10327_high_9
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 20 - 389
Target Start/End: Complemental strand, 18997771 - 18997408
Alignment:
| Q |
20 |
cggatgagcgaatcttccagaagctgagagcggcggtgatagcaagccaagtccataagttgttgagaattgtgattaaaccaaagtttaagtagttgaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18997771 |
cggatgagcgaatcttccagaagctgagagcggcggtgatagcaagccaagtccataagttgttgagaattgtgattaaaccaaagtttaagtagttgaa |
18997672 |
T |
 |
| Q |
120 |
ggctaaagcctcaacgttggaatctaacaagaggttcattatctttattgttttggtttaggttnnnnnnnnnnnnnnnnnnnntttgagaggaatgaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
18997671 |
ggctaaagcctcaacgttggaatctaacaagaggttcattatctttattgttttggtttagttttgtggtgtgtgtgtg-----tttgagaggaatgaat |
18997577 |
T |
 |
| Q |
220 |
tgaataagagagatggattgaggaggctgaagatataagggagtgggaggaagagagaaatgagggtgggtgggatctctaataagatgcctagaatcga |
319 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18997576 |
tgaataagagaaatggattgaggaggctgaagatataagg-agtgggaggaagagagaaatgagggtgggtgggatctctaataagatgcctagaatcga |
18997478 |
T |
 |
| Q |
320 |
taagtaagatgccatttattctaaggtatattacatttgctgacagacatacatgcattcttctctgctc |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
18997477 |
taagtaagatgccatttattctaaggtatattacatttgctgacacacatacatgcattcctctttgctc |
18997408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University