View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_12 (Length: 394)
Name: NF10327_low_12
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 20724259 - 20724120
Alignment:
| Q |
18 |
gcagagagagttgggctttgggatccaaaccctaatgatgaaaacctataaacatactatcatagagcccatgatttttgcagtaaagaaatcaacatct |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20724259 |
gcagagagagttggactttgggatccaaaccctagtgatgaaaacctataaacatactatcatagagcccatgatttttgcagtaaagaaatcaacatct |
20724160 |
T |
|
| Q |
118 |
tgaaggaactatagctttatgcgcaccatgtccaagatca |
157 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20724159 |
tgaaggaactctagctttatgcgcaccatgtccaacatca |
20724120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 278 - 377
Target Start/End: Complemental strand, 20724125 - 20724026
Alignment:
| Q |
278 |
acatcagttttaatggtgctccaataagtatgaaagaaaaaggcaccaaactcaatggcccaagagcactctccttgttgaggacataaacatcattttt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20724125 |
acatcagttttaatggtgctccaataagtatgaaagaaaaaggcaccaaacccaatggcccaggagcactctccttgttgaggacataaacatcattttt |
20724026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 143 - 209
Target Start/End: Original strand, 42902412 - 42902478
Alignment:
| Q |
143 |
ccatgtccaagatcactttcctcgatttatttgagtttgaggaaaatcatttcttatattatctgca |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| ||| |||||||||||| |||||||||| |
|
|
| T |
42902412 |
ccatgtccaagatcacttttgtcgatttatttgactttgcggacaatcatttcttacattatctgca |
42902478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University