View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_26 (Length: 290)
Name: NF10327_low_26
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 1155568 - 1155724
Alignment:
| Q |
1 |
aagcttctttgagaaga--gaagctacgggaacggttttatagagactgttaagcaatcataaagtgacgcgtgtcctttctctgtaaccgttttttgtt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155568 |
aagcttctttgagaagatagaagctacgggaacggttttatagagactgttaagcaatcataaagtgacgcgtgtcctttctctgtaaccgttttttgtt |
1155667 |
T |
 |
| Q |
99 |
agttgaaacggaatggaatctcgctttgctctgttaagtaatcaccctgtgtttggt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155668 |
agttgaaacggaatggaatctcgctttgctctgttaagtaatcaccctgtgtttggt |
1155724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 208 - 271
Target Start/End: Original strand, 1155777 - 1155840
Alignment:
| Q |
208 |
tgccaacttctcttgtttggaagaccagagaaataggcgagagatgctaaattggtgtgggtcc |
271 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1155777 |
tgccaacttctcttgtttggaagaccatagaaataggcgagagatgctaaattggtgtgggtcc |
1155840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University