View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_27 (Length: 282)
Name: NF10327_low_27
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 16 - 272
Target Start/End: Original strand, 42769382 - 42769638
Alignment:
| Q |
16 |
ataactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagttttgggtttaggtcctgtatttccagca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42769382 |
ataactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagttttgggtttaggtcctgtatttccagca |
42769481 |
T |
|
| Q |
116 |
gaactaactacaacaatgccattagcaactgcatggaaagaccctatagcaatactgctttcataaaattctacgggatcaccacccacagacgccgaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42769482 |
gaactaactacaacaatgccattagcaactgcatggaaagaccctatagcaatactgctttcataaaattctacgggatcaccacccacagacgccgaaa |
42769581 |
T |
|
| Q |
216 |
tcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaatgtccgcttcat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42769582 |
tcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaatgtctgcttcat |
42769638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 261
Target Start/End: Original strand, 42716901 - 42717147
Alignment:
| Q |
18 |
aactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagttttgggtttaggtcctgtatttccagcaga |
117 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| | | ||| ||||||||||||||| |||| | || |||||||| |||||| ||| |
|
|
| T |
42716901 |
aactagtgaactctctatcaattgtacttgcagcaactgtaaacacccatggttccaagttggatacagtactaggagcaggtcctgaatttcctccagc |
42717000 |
T |
|
| Q |
118 |
actaactacaacaatgccattagcaactgcatggaaagaccctatagcaatactgctttcataaaattctacggg---atcaccacccacagacgccgaa |
214 |
Q |
| |
|
| || |||| ||| ||| ||||||||||||||||||||||| | ||||||||| || |||||||| || || ||||||||||| |||| | ||| |
|
|
| T |
42717001 |
agccacaacaattatgttattggcaactgcatggaaagaccctatggaaatactgctatcgtaaaattcaacaggaaaatcaccacccaaagacactgaa |
42717100 |
T |
|
| Q |
215 |
atcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaat |
261 |
Q |
| |
|
| ||| || ||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
42717101 |
agcacgtcgacaccatcacttatggcagcttcaaaaccagccaaaat |
42717147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 140 - 261
Target Start/End: Complemental strand, 42734862 - 42734738
Alignment:
| Q |
140 |
gcaactgcatggaaagaccctatagcaatactgctttcataaaattctacggga---tcaccacccacagacgccgaaatcacatcaacaccgtcaagta |
236 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| || | |||||| || ||| ||||||| || |||| | |||| |||||||||||| ||| || |
|
|
| T |
42734862 |
gcaactgcatggaaagaccctatggaaatactgctatcgtgaaattcaacaggaaaatcaccactcaaagacactgaaagcacatcaacaccatcactta |
42734763 |
T |
|
| Q |
237 |
tggcagcttcgaaaccagccaaaat |
261 |
Q |
| |
|
|||||||||| |||||||||||||| |
|
|
| T |
42734762 |
tggcagcttcaaaaccagccaaaat |
42734738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 42762694 - 42762759
Alignment:
| Q |
199 |
acccacagacgccgaaatcacatcaacaccgtcaagtatggcagcttcgaaaccagccaaaatgtc |
264 |
Q |
| |
|
||||| |||| |||||| |||||||||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
42762694 |
acccaaagacaccgaaagcacatcaacaccatcacttatggcagcttcaaaaccagccaaaatgtc |
42762759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 16 - 87
Target Start/End: Original strand, 42762505 - 42762576
Alignment:
| Q |
16 |
ataactagtgaattctctatccgttgtacttgcagcaactgtgatcgaccacggttccaagttggatgcagt |
87 |
Q |
| |
|
|||||| ||||| |||||||| |||| |||||||||||||||| || ||| ||||||||||||||| |||| |
|
|
| T |
42762505 |
ataacttgtgaaatctctatcaattgtgcttgcagcaactgtgagcgtccaaggttccaagttggatacagt |
42762576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University