View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_40 (Length: 230)
Name: NF10327_low_40
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 8 - 212
Target Start/End: Original strand, 13271008 - 13271212
Alignment:
| Q |
8 |
gaggaggagcagagaatgattctataaatataagggtttggtgagattaatatatcttaatgaaggatttaaaaatggttagaagaaaactttaaagcca |
107 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13271008 |
gaggagaagaagagaatgattctataaatataagggtttggtgagattaatatatcttaatgaaggatttaaaaatggttagaagaaaactttaaagcca |
13271107 |
T |
 |
| Q |
108 |
cgagttgaagcaaaggcttaacctcaatagttaggtgtttgcgtgaagcaagcatgaaataagctctctcttagttagcactatttctctctcaacacat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13271108 |
cgagttgaagcaaaggcttaacctcaatagttaggtgtttgcgtgaagcaagcatgaaataagctctctcttagttagcactatttctctctcaacacat |
13271207 |
T |
 |
| Q |
208 |
tttgt |
212 |
Q |
| |
|
||||| |
|
|
| T |
13271208 |
tttgt |
13271212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University