View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_41 (Length: 229)
Name: NF10327_low_41
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 44298862 - 44299080
Alignment:
| Q |
1 |
aaattgattaacctgagccacaacacggtaacgcatcaattgttcagcatttacattcttttcatgtccatttgcaaccacaagacc------atgacca |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44298862 |
aaattgattaacctgagccacaacacggtaacgcatcaattgttcagcatttacattcttttcatgtccatttgcaaccacaagaccatgaccatgacca |
44298961 |
T |
|
| Q |
95 |
tgaccaatttgttccggttcctttgtctcagaaccagcttctaaattactagaagaagacgcagaaagtttcttcttaaagaaacttatagaaaaagaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44298962 |
tgaccaatttgttccggttcctttgtctcagaaccagcttctaaattactagaagaagacgcagaaagtttcttcttaaagaaacttatagaaaaagaat |
44299061 |
T |
|
| Q |
195 |
caaccatgagagtaaaaac |
213 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44299062 |
caaccatgagagtaaaaac |
44299080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University