View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_44 (Length: 221)
Name: NF10327_low_44
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 25577581 - 25577384
Alignment:
| Q |
9 |
gaaaagataaataattttatcaaaaatagtaaaactata-gattaataattttctcaaaagtgtcttgaaatgtttaaaaagttctaaaacgacatctaa |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25577581 |
gaaaagattaataattttatcaaaaatagtaaaactataagattaataattttatcaaaagtgtcttgaaatgtttaaaaagttctaaaacgacatctaa |
25577482 |
T |
 |
| Q |
108 |
aaagaaacagcaggagtagctgtcaagggagaggaaccattccacactccaccaagcatcacatactactcgatttgagacttaggcaccccatatac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25577481 |
aaagaaacagcaggagtagctgtcaagggagaggaaccattccacactccactgagcatcacatactactcgatttgagacttaggcaccccatatac |
25577384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University