View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_45 (Length: 220)
Name: NF10327_low_45
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 204
Target Start/End: Complemental strand, 31887718 - 31887523
Alignment:
| Q |
9 |
agagaagaatggaccaatgctattgaaacatattcccatttcattactctttgcacccaccatctttctgttccacaccccaacccacttcaccatcaaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31887718 |
agagaagaatggaccaatgctattgaaacatattcccatttcattactctttgcacccaccatctttctgttccacaccccaacccacttcaccatcaaa |
31887619 |
T |
|
| Q |
109 |
agcttcataaatcactttgcatttccctctgcaaccgggccgaagcaaaatcaaaactccgcgaattcaactcggctttagaagactgtgatcatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31887618 |
agcttcataaatcactttgcatttccctctgcaaccgggccgaagcaaaatcaaaactccgcgaattcaactcggctttagaagactgtgatcatg |
31887523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University