View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10327_low_47 (Length: 217)

Name: NF10327_low_47
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10327_low_47
NF10327_low_47
[»] chr7 (1 HSPs)
chr7 (1-110)||(9939841-9939951)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 9939951 - 9939841
Alignment:
1 atgttaaaattaattttgttgttgaagtatagaggtattatactcgtctattatgttgggtatggtatcgacatt-ttttggtagcaatcaccaacacca 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||    
9939951 atgttaaaattaattttgttgttgaagtatagaggtattatactcgtctattatgttgggtatggtatcgacatttttttcgtagcaatcaccaacacca 9939852  T
100 tcgattatacc 110  Q
    |||||||||||    
9939851 tcgattatacc 9939841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University