View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10327_low_50 (Length: 205)
Name: NF10327_low_50
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10327_low_50 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 33117085 - 33116896
Alignment:
| Q |
16 |
caaaacttgaattgcagagtcctttgttcaagcatcttctccacttcctcaattggaacacctttggtttctggtacgaaaacgaggacaaagaaaattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
33117085 |
caaaacttgaattgcagagtcctttgttgaagcatcttctccacttcctcaattggaacacctttggtttctggtacgaaaacgaggacaaaggaacttg |
33116986 |
T |
 |
| Q |
116 |
ctatgacagcaacaattccaaacaacatgaatgtccatgcaactccaatagcttgtgtgagagataaaaaggattgagaaacaataaggt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116985 |
ctatgacagcaacaattccaaacaacatgaatgtccatgcaactccaatagcttgtgtgagagataaaaaggattgagaaacaataaggt |
33116896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University