View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1032_low_4 (Length: 340)
Name: NF1032_low_4
Description: NF1032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1032_low_4 |
 | |
|
| [»] scaffold0041 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 227 - 330
Target Start/End: Complemental strand, 111904 - 111801
Alignment:
| Q |
227 |
ggttgaaccacatccacattccgcttcagcttctccgccagatatggtacaatttcctttgcatctatcgttccttttaccgtcaccaaatccttccctt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
111904 |
ggttgaaccacatccacattccgcttcagcttctccgccagatatggtacaatttcctttgcatctatcgttccttttaccgtcaccaaatccttccctt |
111805 |
T |
|
| Q |
327 |
catc |
330 |
Q |
| |
|
|||| |
|
|
| T |
111804 |
catc |
111801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 30 - 122
Target Start/End: Complemental strand, 112074 - 111982
Alignment:
| Q |
30 |
ccggttcatatccgtcataccaatacataggagtttgatgcccatatccgtaaccatgatgctccattttattaacctctaccttagttccga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
112074 |
ccggttcatatccgtcataccaatacataggagtttgatgcccatatccataaccatgatgctccattttattaacctctaccttagttccga |
111982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 104; Significance: 8e-52; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 227 - 330
Target Start/End: Original strand, 41143407 - 41143510
Alignment:
| Q |
227 |
ggttgaaccacatccacattccgcttcagcttctccgccagatatggtacaatttcctttgcatctatcgttccttttaccgtcaccaaatccttccctt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41143407 |
ggttgaaccacatccacattccgcttcagcttctccgccagatatggtacaatttcctttgcatctatcgttccttttaccgtcaccaaatccttccctt |
41143506 |
T |
|
| Q |
327 |
catc |
330 |
Q |
| |
|
|||| |
|
|
| T |
41143507 |
catc |
41143510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 30 - 122
Target Start/End: Original strand, 41143237 - 41143329
Alignment:
| Q |
30 |
ccggttcatatccgtcataccaatacataggagtttgatgcccatatccgtaaccatgatgctccattttattaacctctaccttagttccga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41143237 |
ccggttcatatccgtcataccaatacataggagtttgatgcccatatccataaccatgatgctccattttattaacctctaccttagttccga |
41143329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 295
Target Start/End: Complemental strand, 1654879 - 1654811
Alignment:
| Q |
227 |
ggttgaaccacatccacattccgcttcagcttctccgccagatatggtacaatttcctttgcatctatc |
295 |
Q |
| |
|
||||||||||| | |||||| || ||| ||||||||||| || ||||||||||||||| ||||||||| |
|
|
| T |
1654879 |
ggttgaaccaccttcacatttcgtatcaccttctccgccatatctggtacaatttccttcgcatctatc |
1654811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University