View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10330_high_16 (Length: 329)
Name: NF10330_high_16
Description: NF10330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10330_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 5055447 - 5055130
Alignment:
| Q |
1 |
ggaactgtacaatttcttagagggagagtaaacaatgatcctgatcctgatgatgcaaagctttgtgaagggatgctgaattgttcatagagagccattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5055447 |
ggaactgtacaatttcttagagggagagtaaacaatgatcctgatcctgatgatgcaaaactttgtgaagggatgctgaattgttcatagagagccattt |
5055348 |
T |
|
| Q |
101 |
tattccttggaggtgcttttggtcctcctttctctgcatctttaacatgcaacctaggaaacattggacttatctcctttccctcgtcaattgccccttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5055347 |
tattccttggaggtgcttttggtcctcctttctctgcatctttaacatgcaacctaggaaacattggacttatctcctttccctcgtcaattgccccttt |
5055248 |
T |
|
| Q |
201 |
catcctcttcctttttccacactctatcaactcataaaaagcttctcatctttgccaaatttacaaagtatatagtttacattcctttcgcataaaaatg |
300 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5055247 |
catcctattcctttttccacactctttcaactcataaaaagcttctcatctttgccaaatttacaaagtatatagtttacattcctttcgcataaaattg |
5055148 |
T |
|
| Q |
301 |
ccaatagagtatgttctt |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5055147 |
ccaatagagtatgttctt |
5055130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 78 - 246
Target Start/End: Complemental strand, 5052223 - 5052054
Alignment:
| Q |
78 |
gaattgttcatagagagccattttattccttggaggtgcttttggtcctcctttctctgcatctttaacatgcaacctaggaaacattggacttatctcc |
177 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| |||| |||||| |||||||||||| |||||||| ||||| ||||| || ||||||||||||||| |
|
|
| T |
5052223 |
gaattgttcgtagagagccattttattcgttgggggtgattttggccctcctttctctaaatctttaatgtgcaatctagggaatattggacttatctcc |
5052124 |
T |
|
| Q |
178 |
tttccctcgtcaattgcccctttcat-cctcttcctttttccacactctatcaactcataaaaagcttct |
246 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||| |||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
5052123 |
tttctctcatcaattgcccctttcatccctattccttttcccacactctatcaactcacaaaaaacttct |
5052054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 79 - 158
Target Start/End: Complemental strand, 47903815 - 47903736
Alignment:
| Q |
79 |
aattgttcatagagagccattttattccttggaggtgcttttggtcctcctttctctgcatctttaacatgcaacctagg |
158 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |||| ||||| ||||||| ||| |||||| |||||||| |
|
|
| T |
47903815 |
aattgctcatagagagccattttattcctaggaggtgctcttggccctcccttctctgtatcaccaacatgtaacctagg |
47903736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University