View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10330_high_25 (Length: 251)
Name: NF10330_high_25
Description: NF10330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10330_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 38775651 - 38775577
Alignment:
| Q |
1 |
tttacaatagttaaaaagatcaattttttcatatggattaaaagcgaaagtttaaatattacaataacaatcaat |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38775651 |
tttacaatagttaaaaagatcaattttttcatatggattaaaagcaaaagtttaaatattacaataacaatcaat |
38775577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 118 - 162
Target Start/End: Complemental strand, 38775465 - 38775421
Alignment:
| Q |
118 |
tacttttattgaagtgttgaaagagtgtcttagaggatgtgatca |
162 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38775465 |
tacttttattggagtgttgaaagagtgtcttagaggatgtgatca |
38775421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University