View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10330_high_27 (Length: 250)
Name: NF10330_high_27
Description: NF10330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10330_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 63 - 239
Target Start/End: Original strand, 43385911 - 43386087
Alignment:
| Q |
63 |
gattaacttagcattaattggaagaagaggttgctgaagggttctgctgtggccattcattggaatacaccaaagacactggggtgcagtatgaattgca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43385911 |
gattaacttagcattaattggaagaagaggttgcagaagggttctgctgtggccattcattggaatacaccaaagacactggggtgcagtatgaattgca |
43386010 |
T |
 |
| Q |
163 |
ggggctttcgtgattgtgaacaccttcatagcttgttaacacatagcttgaatcttccctatccctttccacccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43386011 |
ggggctttcgtgattgtgaacaccttcatagcttgttaacacatagcttgaatcttccctatccctttccacccttt |
43386087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 63 - 132
Target Start/End: Complemental strand, 1692053 - 1691984
Alignment:
| Q |
63 |
gattaacttagcattaattggaagaagaggttgctgaagggttctgctgtggccattcattggaatacac |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||| | |||||||||||||||||||| |
|
|
| T |
1692053 |
gattaacttagcattaattggaagaagaggttgcagaagggtgctgcagcggccattcattggaatacac |
1691984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 63 - 132
Target Start/End: Original strand, 8775319 - 8775388
Alignment:
| Q |
63 |
gattaacttagcattaattggaagaagaggttgctgaagggttctgctgtggccattcattggaatacac |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||| | |||||||| ||||||||||| |
|
|
| T |
8775319 |
gattaacttagcattaattggaagaagaggttgcagaagggtgctgcagcggccattcgttggaatacac |
8775388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 179 - 244
Target Start/End: Original strand, 38399322 - 38399387
Alignment:
| Q |
179 |
tgaacaccttcatagcttgttaacacatagcttgaatcttccctatccctttccaccctttgcttc |
244 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| ||||| || ||||||||||||||||||| |||| |
|
|
| T |
38399322 |
tgaacaccttcataacttgttatcacatagctcgaatcatctctatccctttccacccttttcttc |
38399387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University