View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10330_high_32 (Length: 239)
Name: NF10330_high_32
Description: NF10330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10330_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 23 - 223
Target Start/End: Original strand, 44634112 - 44634313
Alignment:
| Q |
23 |
aaacataaaaagttgtgaaagaaagaaa-caattgaattggcctatgtgtcaaaattagattgaccggtcaattttatataacatttcggccataatgtc |
121 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44634112 |
aaacataaaaagttgtgtaagaaagaaaacaattgaattggcctatgtgtcaaaattagattgaccggtcaatgttatataacatttcggccataatgtc |
44634211 |
T |
 |
| Q |
122 |
attgaagtgcaatcctataagcaatgggaactagaataagacccacacgtggcgcggctcaaaattatatttgaggtattatgcgataatttatgaaaga |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44634212 |
attgaagtgcaatcctataaacaatgggaactagaataagactcacacgtggcgcggctcaaaattatatttgaggtattatgcgataatttataaaaga |
44634311 |
T |
 |
| Q |
222 |
ag |
223 |
Q |
| |
|
|| |
|
|
| T |
44634312 |
ag |
44634313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University