View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10330_low_16 (Length: 379)
Name: NF10330_low_16
Description: NF10330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10330_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 1 - 361
Target Start/End: Original strand, 11698266 - 11698626
Alignment:
| Q |
1 |
tgtctttcatgctggcgcgagatttcctgcataattggcaacaggtctgccagtccaggacagggaaccgcggtgagtctaggcaggaggaagttccccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11698266 |
tgtctttcatgctggcgcgagatttcctgcataattggcaacaggtctgccagtccaggacagggaaccgcggtgagtctaggcaggaggaagttccccg |
11698365 |
T |
|
| Q |
101 |
atgaagcaaaccaaatgccggtaagttgaaatgcaatgtggacgctgcagtggttactaaccagaacatatttggaattggtatgtgcatccgtaaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11698366 |
atgaagcaaaccaaatgccggtaagttgaaatgcaatgtggacgctgcagtggttactaaccagaacatatttggaattggtatgtgcatccgtaaaaat |
11698465 |
T |
|
| Q |
201 |
catggtaagtttgttattgcaaaaacagttgtgttttatggtgtcccttaagcctaagaggttgannnnnnncttgctgaggcgatcaagtagaatggag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11698466 |
catggtaagtttgttattgcaaaaacagttgtgttttatggtgtcccttaagcctaagaggttgagggggggcttgctgaggcgatcaagtagaatggag |
11698565 |
T |
|
| Q |
301 |
agttggactttgataaggtttcaatttaactagattgtaaaccggtggttgacggcatttt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11698566 |
agttggactttgataaggtttcaatttaactagattgtaaaccggtggttgacggcatttt |
11698626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University