View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10330_low_29 (Length: 278)
Name: NF10330_low_29
Description: NF10330
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10330_low_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 42038399 - 42038150
Alignment:
| Q |
18 |
tgtttgacatgacgcttgtatgacatgttgtctagcggactatttggaactctcacaatgatctaatctttgttgggatgatctatttatgttgagttct |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038399 |
tgtttgacatggcgcttgtatgacatgttgtctagcggactatttggaactctcacaatgatctaatctttgttgggatgatctatttatgttgagttct |
42038300 |
T |
|
| Q |
118 |
tgttggatagggcaaagtttgatcgatagggcaaaattttgatggtggaagtgtttctcggtaaaatcttggcagtgcatacttcttctatgagtgggag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038299 |
tgttggatagggcaaagtttgatcgatagggcaaaattttgatcgtggaagtgtttctcggtaaaatcttggcagtgcatacttcttctatgagtgggag |
42038200 |
T |
|
| Q |
218 |
acacatccagccatgagttggaaccgtagaatcttgtgtgagtgtctgtg |
267 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038199 |
acacatccagccgtgagttggaaccgtagaatcttgtgtgagtgtctgtg |
42038150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University