View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10331_high_2 (Length: 426)
Name: NF10331_high_2
Description: NF10331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10331_high_2 |
 | |
|
| [»] scaffold0188 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 6e-47; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 73 - 184
Target Start/End: Original strand, 13765257 - 13765368
Alignment:
| Q |
73 |
cttcatcaaatatataaaatatggaccaacaaattctccatggcatccctaactctgataaattcacacgcaacttgatcaatagtcacattatcaactt |
172 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
13765257 |
cttcctcaaatatataaaatatggaccaacaaattctccatggcatccctaactctgaaaaattcacgcgcaacttgatcaatagtgacattatcaactt |
13765356 |
T |
|
| Q |
173 |
gaggaatcatca |
184 |
Q |
| |
|
|||||||||||| |
|
|
| T |
13765357 |
gaggaatcatca |
13765368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 58 - 141
Target Start/End: Original strand, 14152611 - 14152694
Alignment:
| Q |
58 |
taaacaatatttgaccttcatcaaatatataaaatatggaccaacaaattctccatggcatccctaactctgataaattcacac |
141 |
Q |
| |
|
|||||| |||||| |||||| | | |||||||||||||| ||||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
14152611 |
taaacactatttgtccttcaaccactatataaaatatggtccaacaaatcctccatcacatccctaactcgtataaattcacac |
14152694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 234 - 307
Target Start/End: Original strand, 14152808 - 14152882
Alignment:
| Q |
234 |
cactatcacaac-ttcaaagttggaatcatgctgaagaattgaaattttgttcttgttcttacagtaaagttgtt |
307 |
Q |
| |
|
|||||||||||| || ||||||||||||||| ||| || ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
14152808 |
cactatcacaaccttaaaagttggaatcatgtggaattatggaagttttgttcttgttcttatggtaaagttgtt |
14152882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 316 - 374
Target Start/End: Complemental strand, 14585 - 14527
Alignment:
| Q |
316 |
taaaaagattgtatgttcatagagaagcaagagatcactcgatgcagaccaggatgata |
374 |
Q |
| |
|
|||||||||||||||| || ||||||| ||||||||| ||||| |||||| ||||||| |
|
|
| T |
14585 |
taaaaagattgtatgtgcactgagaagcgagagatcacccgatgaagaccacgatgata |
14527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University