View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10331_low_8 (Length: 206)
Name: NF10331_low_8
Description: NF10331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10331_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 3961725 - 3961551
Alignment:
| Q |
14 |
agagaaagatacggtgaaatgttgatttaacaagttttggcatatctgtttacgtacgatcgaatatctactattgcatgttgttattatatgcattttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3961725 |
agagaaagatacggtgaaatgttgatttaacaagttttggcatatctgtttacgtacgatcgaatatctactattgcatgttgttattatatgcattttg |
3961626 |
T |
 |
| Q |
114 |
atgtagagccaaattcaatccagcaaagtagccagctagctccattccttcaatccattatttgccatattggac |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3961625 |
atgtagagccaaattcaatccagcaaagtagccagctagctccattccttcaatccattatttgctatattggac |
3961551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University