View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10333_low_1 (Length: 410)
Name: NF10333_low_1
Description: NF10333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10333_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 24 - 227
Target Start/End: Original strand, 36595874 - 36596075
Alignment:
| Q |
24 |
cccttatttatttgttttttgtgggttcccgtttcatttgttggttatgaacctagacgtgatttatgtgtctgg-tgtacctttttcatttttggttac |
122 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36595874 |
cccttatttatttgttttttgtgagttcacgtttcatttgttggttatgaacctagacgtgatttatgtgtctgggtgtacctttttcatttttggttac |
36595973 |
T |
|
| Q |
123 |
aggttaatctaaaatgggaaatttatttattatggataagtataacaacctaaggtgattcggaggatccaacggttttacagagatgtagagagtcatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36595974 |
gggttaatctaaaatgggaaatttatttattacggataagtgtaacaacctaaggtgattc---ggatccaacggttttacagagatgtagagagtcatg |
36596070 |
T |
|
| Q |
223 |
acata |
227 |
Q |
| |
|
||||| |
|
|
| T |
36596071 |
acata |
36596075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 295 - 401
Target Start/End: Original strand, 36596142 - 36596248
Alignment:
| Q |
295 |
aggcgcattctaacataagcagcaactgaaacatatcggaaaatgtgcgtgagagaaaatacgacaaagacatcttacaaatctcttctgtcaatttatc |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
36596142 |
aggcgcattctaacataagcagcaactgaaacatatcggaaaatgtgcgtgagagaaaatacgacaaacgcatcttacaattctcttctgtcaatttatc |
36596241 |
T |
|
| Q |
395 |
aaatttc |
401 |
Q |
| |
|
||||||| |
|
|
| T |
36596242 |
aaatttc |
36596248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University