View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10334_low_2 (Length: 308)
Name: NF10334_low_2
Description: NF10334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10334_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 5139643 - 5139922
Alignment:
| Q |
18 |
atgtcatgcattatgtgttgaacattaatgattcggtggctgagagcatattttctatccagactttaagtgcagacgaaagaaaattattttgttgcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
5139643 |
atgtcatgcattatgtgttgaacattaatgattcggtggctgagagcatattttctatgcagactttaagtgcagaccaaaaagaattattttgttgcac |
5139742 |
T |
|
| Q |
118 |
tatatatgatctatatggaaataaaggagtactcatgttaggagaaatgaagcgggtatgatcaagcataatttgtgcttgctaaaactaaatggatcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5139743 |
tatatatgatctatatggaaataaaggagtactcatgttaggagaaatgaagcgggtatgatcaagcataatttgtgcttgctaaaactaaatggatcaa |
5139842 |
T |
|
| Q |
218 |
acctggggaggacataggtataggctaccaagatttgactgtaactcttctcaccatatgaaggttctcaaccaccctatg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
5139843 |
acctggggaggacataggtataggctaccaagatttgactgtaactcttctcaccatacg-aggttctcaaccatcctatg |
5139922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University