View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10334_low_6 (Length: 234)
Name: NF10334_low_6
Description: NF10334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10334_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 173
Target Start/End: Original strand, 52810717 - 52810878
Alignment:
| Q |
12 |
agcagagatcaatgatataaagaaacccattgtccacttccctgtgtcctcataatagaccaatacagtattggagaacaaagatccaacgttgagggaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52810717 |
agcagagatcaatgatataaagaaacccattgtccacttccccgtgtcctcataatagaccaatacagtattggagaacaaagatccaacgttgagggaa |
52810816 |
T |
|
| Q |
112 |
aagtaaaaataacagaagaaagctacttttaaactcctctcttttggattcctctcatcata |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52810817 |
aagtaaaaataacagaagaaagctacttttaaactcctctcttttggattcctctcatcata |
52810878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 170 - 218
Target Start/End: Original strand, 52815189 - 52815237
Alignment:
| Q |
170 |
catagacttatgacagcaaataacagtcttcgatacaagacaagataat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52815189 |
catagacttatgacagcaaataacagtcttcgatacaagacaagataat |
52815237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University