View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10335_high_2 (Length: 255)
Name: NF10335_high_2
Description: NF10335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10335_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 1967981 - 1968208
Alignment:
| Q |
16 |
gttgcatagtaagagatcagattcatctaggaagaatattccagagttaaggacacaaaggtctcatttgaatcaagcagcaatagatttctccgattct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1967981 |
gttgcatagtaagagatcagattcatctaggaagaatattccagagttaagggcacaaaggtctcatttgaatcaagcagcaatagatttctccgattct |
1968080 |
T |
 |
| Q |
116 |
attaaaaaggaacagggcatgtcaggccgagacaccggaatggtaaacaacaactttctctttactgttatcaactttctatttatcaacttcctcttgn |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1968081 |
attaaaaaggaacagggcatgtcaggccgagacaccggaatggtaaacaacaactttctctttactgttatcaactttctatttatcaacttcctcttgt |
1968180 |
T |
 |
| Q |
216 |
nnnnnnatatggtcaaggtttatttttc |
243 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1968181 |
ttttttatatggtcaaggtttatttttc |
1968208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University