View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10335_low_1 (Length: 349)
Name: NF10335_low_1
Description: NF10335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10335_low_1 |
 |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 47114363 - 47114554
Alignment:
| Q |
1 |
gtaacccacataatgtttccaattacttgaaagcaacaagaggatgattatcttgtgaattgagaattgtgaaacgacactcaatctttnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47114363 |
gtaacccacatattgtttccaattacttgaaagcaacaagaggatgattatcttgtgaattgagaattgtgaaacaacactcaatctttaaaaaaaataa |
47114462 |
T |
 |
| Q |
101 |
nnntgaaagattaaaattgaagaatgaaggttgtcgaaggttgaaagagagtgagaaagaatacaaaaccatcaacatagcaattattatta |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47114463 |
aaatgaaagattaaaattgaagaatgaaggttgtcgaaggttgaaagagagtgagaaagaatacaaaaccatcaacatagcaattattatta |
47114554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 191 - 331
Target Start/End: Original strand, 19180 - 19320
Alignment:
| Q |
191 |
taggggtggacaaacggtcggttcggccggatttcggttcaaaaatctaaatccgaacgtcaaccgcgggtggtattaagcagtccaattccgtccatca |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
19180 |
taggggtggacaaacggtcggttcggccggattttggttcaaaaatctaaatccgaacgtcaaccgcgggtggtattaagcagtccaaatccgcccatca |
19279 |
T |
 |
| Q |
291 |
caacactcggttattgcggttttcgggttgggcgaaatacg |
331 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
19280 |
caacactcggttattgcggttttcggattgggtgaaatacg |
19320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 191 - 263
Target Start/End: Original strand, 24214336 - 24214408
Alignment:
| Q |
191 |
taggggtggacaaacggtcggttcggccggatttcggttcaaaaatctaaatccgaacgtcaaccgcgggtgg |
263 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||| | ||||| || |||||||| | |||||||||||| |
|
|
| T |
24214336 |
tagggctggacaaacggtcggttcggtcggatttcgggtgaaaaacctcaatccgaaggcaaaccgcgggtgg |
24214408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 263
Target Start/End: Original strand, 40158454 - 40158526
Alignment:
| Q |
191 |
taggggtggacaaacggtcggttcggccggatttcggttcaaaaatctaaatccgaacgtcaaccgcgggtgg |
263 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||| || | ||||| || |||||||| | |||||||||||| |
|
|
| T |
40158454 |
tagggctggacaaacggtcggttcggtcggattttgggtgaaaaacctcaatccgaaggcaaaccgcgggtgg |
40158526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University