View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10335_low_3 (Length: 253)
Name: NF10335_low_3
Description: NF10335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10335_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 42037803 - 42037678
Alignment:
| Q |
1 |
aatacttatgcttattatattatcaatactgatgtgtannnnnnn-aatggcaaacaaagaaatattattgaaaattggaagagaaaagtacaagagtta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42037803 |
aatacttatgcttattatattatcaatactgatgtgtattttttttaatggcaaacaaagaaatattattgaaaattggaggagaaaagtacaagagtta |
42037704 |
T |
|
| Q |
100 |
acaaaactcttaaaacccgtgagtga |
125 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42037703 |
acaaaactcttaaaacccgtgagtga |
42037678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 209
Target Start/End: Complemental strand, 42037631 - 42037599
Alignment:
| Q |
177 |
gcaatgatgttggtttatgatgcagattccttg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42037631 |
gcaatgatgttggtttatgatgcagattccttg |
42037599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University