View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10335_low_4 (Length: 251)
Name: NF10335_low_4
Description: NF10335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10335_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 2 - 231
Target Start/End: Complemental strand, 32440306 - 32440075
Alignment:
| Q |
2 |
gagagggagcaaacttcatttatttccacatttaacaacaacatcaatgtcaacgaaggctctgtcatacaaaatgtggtagactcttacaacataacaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
32440306 |
gagagggagcaaacttcatttatttccacatttaacaacaacatcaatgtcaatgaaggctttgtcacacaaaatgtgctagactcttacaacatgacaa |
32440207 |
T |
|
| Q |
102 |
actaaaattacaatatcnnnnnnngaaaataattgtacacaaagtcnnnnnnnattagtgtccttccatagtttaaacattcgttatgtatatttcaggt |
201 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||||| | ||||||| ||||||||||||||||||| |||||||||||||| || |
|
|
| T |
32440206 |
actaaaattacaatatcaaaaaaagaaaaaagttgtacacaaagtctttctttactagtgtcattccatagtttaaacattccttatgtatatttcacgt |
32440107 |
T |
|
| Q |
202 |
aaatattcagacaagttg--ggtgtaattaat |
231 |
Q |
| |
|
| ||||||| | |||||| |||||||||||| |
|
|
| T |
32440106 |
acatattcacataagttggcggtgtaattaat |
32440075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University